dCas9-DNMT3A Lentivirus
Cat. No.
K092
Unit
4 x 500ul
Price
$625.00
| Cat. No. | K092 |
| Name | dCas9-DNMT3A Lentivirus |
| Unit | 4 x 500ul |
| Description |
This construct consists of the catalytic domain of DNA methyltransferase (DNMT3A) fused to the C-terminus of Cas9 Double Mutant (dCas9). The Cas9 Double Mutant has changes at amino acid positions D10A and H840A which completely inactivate both nuclease and nickase activities. The DNMT3A domain facilitates CpG site methylation leading to transcriptional down-regulation. By using specific sgRNAs, the dCas9-DNMT3A can be targeted to a promoter region allowing for epigenetic control over the expression of almost any gene of interest. |
| Vector | pLenti-EF1a-dCas9-DNMT3A |
| Titer | 107 IU/mL |
| Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. K092 |
Print & Download Datasheet
Search CoA here
There are no Documents for this product yet!
| How long after transduction can the infection efficiency be observed? | |
|
You can observe transduction efficiency from 48 hours up to 5 days after infection.
|
| What are the primers to use for SV40T and SV40T tsA58 detection? | |
|
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.
|
| What is the sequence of the SV40 large T antigen? | |
|
This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.
|
| For G221 and LV620, what does the 'V12' in RasV12 mean? | |
|
The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).
|
| Where is the SV40T tsA58 gene sequence? | |
|
The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.
|
- Bayati, A et al. (2022). "Rapid macropinocytic transfer of α-synuclein to lysosomes." Cell Reports. 40(3):111102. DOI: 10.1016/j.celrep.2022.111102. Application: Organelle Labeling Lentivirus.
This product has no review yet.