Lenti-SV40 Lentivirus, High Titer
Cat. No.
LV612
Unit
2 x 100 µl
Price
$1025.00
| Cat. No. | LV612 |
| Name | Lenti-SV40 Lentivirus, High Titer |
| Unit | 2 x 100 µl |
| Description |
High Titer Lentivirus expressing SV40 whole gene (109 IU/ml) |
| Application |
Reliable and commonly used. Often used to immortalize epithelial cells. |
| Expression System Type | Lentivirus |
| Vector Map | pLenti SV40 |
| Note |
*For for-profit organizations and corporations, the purchase price is 1.5 times the listing price. |
| Caution |
NOT FOR RESALE without prior written consent of abm. This product is distributed for laboratory research only. Caution: Not for diagnostic use. |
| Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. LV612 |
Print & Download Datasheet
|
What PCR primers can I use for SV40 detection?
|
|
|
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
Expected band size: 792bp
|
| What qPCR primers can I use for SV40 detection? | |
|
SV40 Forward Primer Sequence
TTCCCTGACCTGAAGGCAAATC
SV40 Reverse Primer Sequence
GGCTGAACTTTGAGCTAGGAGTAG
|
- Wu, L et al. " Immortalized Mouse Floxed Bmp2 Dental Papilla Mesenchymal Cell Lines Preserve Odontoblastic Phenotype and Respond to BMP2. J. Cell" Physiol 225:132-139 (2010). DOI: 10.1002/jcp.22204. Application: Immortalization.
- Olyslaegers, D et al. "Generation and characterization of feline arterial and genous endothelial cell lines for the study of the vascular endothelium" BMC Veterinary Research 9:170 (2013). DOI: 10.1186/1746-6148-9-170. Application: Immortalization.
- Desmarets, L et al. "Establishment of feline intestinal epithelial cell cultures for the propagation and study of feline" Veterinary Research 44:71 (2013). DOI: 10.1186/1297-9716-44-71. Application: Immortalization.
- Balducci, L et al. "Immortalization of human adipose-derived stromal cells: production of cell lines with high growth rate, mesenchymal marker expression and capability to secrete high levels of angiogenic factors" Stem Cell Research & Therapy 3:63 (2014). DOI: 10.1186/scrt452. PubMed: 24887516. Application: Immortalization.
- Wong, SY et al. "Primary cilia can both mediate and suppress Hedgehog pathway–dependent tumorigenesis" Nat. Med. 9:1055 - 1061 (2009). DOI: doi:10.1038/nm.2011. PubMed: 19701205. Application: Immortalization.
- Wang, ZY et al. "Immortalized porcine liver sinusoidal endothelial cells: an in vitro model of xenotransplantation-induced thrombocytopenia" Xenotransplantation 19:249-55 (2012). PubMed: 22909138.
- Chen, Q et al. "Pharmacological inhibition of S-nitrosoglutathione reductase improves endothelial vasodilatory function in rats in vivo" J. Appl. Physiol. 6:752-60 (2013). DOI: 10.1152/japplphysiol.01302.2012. PubMed: 23349456. Application: Immortalization.
- Zhao, Y et al. "microRNA response elements-regulated TRAIL expression shows specific survival-suppressing activity on bladder cancer." J Exp Clin Cancer Res 32(1):10 (2013). DOI: 10.1186/1756-9966-32-10. PubMed: 23442927. Application: Immortalization.
- Liu, J et al. "Oleanolic acid inhibits proliferation and invasiveness of Kras-transformed cells via autophagy" J Nutr Biochem 25(11):1154-1160 (2014). DOI: 10.1016/j.jnutbio.2014.06.006. PubMed: 25172632.
- Nauwynck, H.J. et al. "Generation and Characterization of feline arterial and cenous endotheilial cell lines for the study of the vascular endothelium " Biomed Central 9: (2013). DOI: 10.1186/1746-6148-9-170. Application: Gene Delivery.
- Laval, et al. "Equine Herpesvirus Type 1 Enhances Viral Replication in CD172a+ Monocytic Cells upon Adhesion to Endothelial Cells" Journal of Virology 21:10912-10923 (2015). DOI: 10.1128/JVI.01589-15.
- Liu, et al. "Immortalized Mouse Floxed Fam20c Dental Papillar Mesenchymal and Osteoblast Cell Lines Retain Their Primary Characteristics" Journal of Cellular Physiology 11:2581-2587 (2015). DOI: 10.1002/jcp.25008.
- Coleman, S et al. "A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus" PLoS Pathog 12.7:e1005755 (2016). DOI: 10.1371/journal.ppat.1005755. Application: Immortalization.
- Jester, JV et al. "PPARγ Regulates Mouse Meibocyte Differentiation and Lipid Synthesis" The Ocular Surface 14.4:484-494 (2016). DOI: 10.1016/j.jtos.2016.08.001. Application: Immortalization.
- Wang, ZY et al. "Immunogenicity of Renal Microvascular Endothelial Cells From Genetically Modified Pigs" Transplantation 100.3:533-537 (2016). DOI: 10.1097/TP.0000000000001070. Application: Immortalization.
This product has no review yet.