Lenti-SV40 Virus, High Titer
| Cat. No. | LV612 |
| Name | Lenti-SV40 Virus, High Titer |
| Unit | 2 x 100 µl |
| Unpacking and Storage Instructions |
Lentiviruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles. |
| Description |
High Titer (109 IU/ml) Recombinant Lentivirus expressing the SV40 whole gene. |
| Application |
Cell immortalization. |
| Expression System Type | Lentivirus |
| Caution |
This product is distributed for laboratory research only. |
| Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. LV612 |
Print/Download Datasheet
|
What primers can I use for SV40 detection?
|
|
|
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
Expected band size: 792bp
qPCR Primers: SV40T Forward Primer Sequence 5' TTCCCTGACCTGAAGGCAAATC 3' SV40T Reverse Primer Sequence 5' GGCTGAACTTTGAGCTAGGAGTAG 3' |
| Do I need to remove antibiotics (penicillin, streptomycin) before immortalizing my cells with the SV40T antigen viruses? | |
|
No. Routine cell culture antibiotics do not interfere with the SV40T antigen virus infection efficiency.
|
| What is the general procedure for immortalizing cells? | |
|
See our Cell Immortalization Handbook for more details.
|
| Can you recommend a specific reagent and protocol to immortalize my cell line? | |
|
Successful cell immortalization is unpredictable and must be determined experimentally, as results vary with species, tissue origin, growth characteristics and whether or not specific cell functions need to be preserved.
Our in-house experiments using the SV40T and hTERT lentiviruses have achieved the highest immortalization success rates in a variety of different cell types. |
| Do immortalized cells retain all characteristics of the original primary cell line? | |
|
Not always. Some phenotypic or genetic changes may occur during immortalization. We recommend using our hTERT immortalization reagents as this method preserves phenotype and karyotype as well as minimizes genomic instability.
|
| Do I need a control when performing cell immortalization experiments? | |
|
Yes. Always include control cells that are not transduced in order to compare growth rates and detect senescence bypass.
|
| How do I confirm successful cell immortalization? | |
|
Assess long-term growth beyond normal passage limits and verify expression of the immortalizing genes via PCR, qPCR or Western blot.
|
| Where can I learn more about cell immortalization? | |
|
Check out our Learning Resources and Youtube video for more information.
|
| How does the SV40T gene immortalize cells? | |
|
SV40T works to shut down p53 and pRb-dependent growth control, thus over-riding the normal safety checkpoints that limit cell division.
|
| Will this virus immortalize my primary cells? | |
|
This is highly dependent on the immortalization reagent and cell type. Check out our Cell Immortalization Reagents Compatibility Chart for more information.
|
- Balducci, L., Blasi, A., Saldarelli, M., Soleti, A., Pessina, A., Bonomi, A., Coccè, V., Dossena, M., Tosetti, V., Ceserani, V., Navone, S., Falchetti, M., Parati, E., & Alessandri, G. (2014). Immortalization of human adipose-derived stromal cells: production of cell lines with high growth rate, mesenchymal marker expression and capability to secrete high levels of angiogenic factors. Stem Cell Research & Therapy, 5(3), 63. https://doi.org/10.1186/scrt452
- Isamu Taiko, Takano, C., Nomoto, M., Hayashida, S., Kazunori Kanemaru, & Miki, T. (2022). Selection of red fluorescent protein for genetic labeling of mitochondria and intercellular transfer of viable mitochondria. Research Square (Research Square). https://doi.org/10.21203/rs.3.rs-2011977/v1
- Liu X, Xia F, Wu X, Tang Y, Wang L, Sun Q, Xue M, Chang W, Liu L, Guo F, Yang Y and Qiu H (2021) Isolation of Primary Mouse Pulmonary Microvascular Endothelial Cells and Generation of an Immortalized Cell Line to Obtain Sufficient Extracellular Vesicles. Front. Immunol. 12:759176. doi: 10.3389/fimmu.2021.759176. Application: Cell Immortalization
-
Nuclear force transmission drives cancer-associated fibroblast activation under BRAF inhibition.
This product has no review yet.
Controls and Related Product: