Lenti-SV40T (Neo) Lentivirus, High Titer
Cat. No. | LV660 |
Name | Lenti-SV40T (Neo) Lentivirus, High Titer |
Unit | 2 x 100 µl |
Description |
High Titer Lentivirus expressing SV40 large T antigen (109 IU/ml) |
Expression System Type | Lentivirus |
Vector Map | pLenti-SV40-T(Neo) |
Note |
*For for-profit organizations and corporations, the purchase price is 1.5 times the listing price. |
Caution |
NOT FOR RESALE without prior written consent of abm. This product is distributed for laboratory research only. Caution: Not for diagnostic use. |
Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. LV660 |
Print & Download Datasheet
What PCR primers can I use for SV40 large T detection? | |
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
Expected band size: 792bp
|
What qPCR primers can I use for SV40 large T detection? | |
SV40 Forward Primer Sequence
TTCCCTGACCTGAAGGCAAATC
SV40 Reverse Primer Sequence
GGCTGAACTTTGAGCTAGGAGTAG
|
- Auciello, F. R., Bulusu, V., Oon, C., Tait-Mulder, J., Berry, M., Bhattacharyya, S., ... & Vringer, E. "A stromal lysolipid–autotaxin signaling axis promotes pancreatic tumor progression" Cancer discovery 9(5):617-627 (2019).
This product has no review yet.