saCas9 Nuclease AAV Virus (AAV5)
Cat. No. | K212 |
Name | saCas9 Nuclease AAV Virus (AAV5) |
Unit | 3 x 100 μl |
Description |
This AAV virus expresses the Cas9 orthologue from Staphylococcus Aureus (saCas9). saCas9 is 1 kb shorter than spCas9, allowing it to be efficiently packaged in AAV Virus. Furthermore, the saCas9 enzyme recognizes a longer PAM sequence than spCas9, and thus has greater editing specificity. |
Vector | pAAV-PGK-saCas9 |
Titer | 1011 GC/mL |
Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. K212 |
Print & Download Datasheet
Search CoA here
There are no Documents for this product yet!
How long after transduction can the infection efficiency be observed? | |
You can observe transduction efficiency from 48 hours up to 5 days after infection.
|
What are the primers to use for SV40T and SV40T tsA58 detection? | |
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.
|
What is the sequence of the SV40 large T antigen? | |
This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.
|
For G221 and LV620, what does the 'V12' in RasV12 mean? | |
The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).
|
Where is the SV40T tsA58 gene sequence? | |
The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.
|
- Bayati, A et al. (2022). "Rapid macropinocytic transfer of α-synuclein to lysosomes." Cell Reports. 40(3):111102. DOI: 10.1016/j.celrep.2022.111102. Application: Organelle Labeling Lentivirus.
This product has no review yet.
Controls and Related Product: