SIRT7 Stable Knockdown H1299 Cell Line

CAT.NOUNITPRICE
T61651x106 cells / 1.0 ml
$0.00

Specifications


DescriptionThe sirtuin family of proteins have a diverse range of biological functions accomplished by the deacetylation of their targets. Derived from H1299 cells; this Sirt7 knockdown cell line was displays lentiviral-driven stable expression shRNA scramble sequences and a Sirt7 specific shRNA. These cells would be suitable for use in the study of the functions of Sirt7 and the sirtuin family of proteins
SKUT6165
SpeciesHuman (H. sapiens)
Tissue/Organ/Organ SystemLung
Cell MorphologyEpithelial-like
Applications

For Research Use Only

Seeding Density10,000 - 20,000 cells/cm2
Population Doubling Time43 - 53 hours
Donor GenderMale
Donor GenderMale
Donor Age43 years old
Cell TypeDrug Discovery Cell Lines
Growth PropertiesAdherent
Expression Profile

Puromycin resistance at the concentration of 5 ug/mL. The cells stably express the short hairpin RNA (shRNA) scramble sequence: 5'-CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTT AGG-3' and the Sirt7 specific shRNA 5'- CCGGGTCCAGCCTGAAGGTTCTAAACTCGAGTTTAGAACCTTCAGGCTGGACTTTTTG-3'.

Preservation Protocol
1. Freeze Medium: 90% FBS and 10% DMSO.
2. Storage Temperature: Liquid nitrogen vapour phase.
Unit quantity1x106 cells / 1.0 ml
QC

1) Immunofluorescence; 2) DNA analysis and qPCR; 3) AgNOR staining

Documents


Supporting Protocol
MSDS

    QC

      Other

      FAQs


      There are no FAQs for this product yet!
      References


      There are no references for this product yet!