PUS1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
-
Retired Cat.No.
38210111 -
Product Name
PUS1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) -
Unit
3 x 1.0 µg DNA -
Description

Save 30% OFF Packaging Mix or Transduction Enhancer with any lentivector or lentivirus. Click here to claim your savings! abm's Knockout sgRNA vectors and viruses are ready to use in your CRISPR Gene Knockout experiment. These vector and virus products come as a set of three sgRNA targets which are designed to guide Cas9 to cleave exonic gDNA resulting in frameshift mutations and ultimately gene knockout. Available constructs include All-in-One (Cas9 and sgRNA expression) and sgRNA only (no Cas9 expression) – navigate to Custom Option to select the latter. Our CRISPR vectors and viruses are also available in a variety of formats including Lentivirus, AAV and Non-Viral.
-
Gene Name/Gene ID
PUS1, 80324 -
Gene Full Name
pseudouridylate synthase 1 -
Accession Number
-
Species
Human -
System
Lentiviral Vector -
Target Sequence
109 CCGGCGAAGAAGCTCAAGAG
190 TATTCGGGCAAGGGCTACCA
389 GTCAATCAGCCACACCTTCA -
Promoter
SFFV-U6 -
Storage Condition
Store Lentiviral Vectors at -20°C. -
QC
Restriction Enzyme Digest and Sequencing -
Disclaimer
-
Guarantee
abm guarantees that at least one out of the three sgRNA Lentiviral constructs purchased in a set designed to be used with Cas9 Nuclease will result in complete gene knockout (due to indel) in over 50% of cells at 1 week after successful transduction and drug selection. Click for more info☛ View our CRISPR Workflow Guide to learn how to use our CRISPR KO products and identify key stages in delivery, selection, and screening.
-
Caution
This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
Please note, only packaging mixes produced by abm have been tested in house and therefore carry our guarantee for high titer virus production. If it is desirable to use other packaging plasmids obtained from a different source, the compatibility must be tested and determined by the end user.