1110008P14Rik CRISPRa sgRNA lentivector (set of three targets)(Mouse)
1110008P14Rik CRISPR
1110008P14Rik Lentiviral
1110008P14Rik AAV
1110008P14Rik Adenovirus
1110008P14Rik ORF
1110008P14Rik siRNA
-
Retired Cat.No.
10036124 -
Product Name
1110008P14Rik CRISPRa sgRNA lentivector (set of three targets)(Mouse) -
Unit
3 x 1.0μg DNA -
Description
abm’s Activation sgRNA lentivectors/lentiviruses are ready to use in your CRISPR Activation experiment. The lentivector/lentivirus products come as a set of three sgRNA targets which are designed to be used with dCas9-VPR. When paired together, the sgRNAs guide dCas9-VPR to the 5’ UTR of the target gene resulting in transcriptional upregulation.
Save 30% OFF Packaging Mix or Transduction Enhancer with any lentivector or lentivirus. Click here to claim your savings! -
Gene Name/Gene ID
1110008P14Rik, 73737 -
Alias
C79326; RP23-161B9.10 -
Accession Number
-
Species
Mouse -
System
Lentiviral Vector -
Target Sequence
Target 1: CCGCCCAAAGCCCAGCCCGT
Target 2: GACCTTGCTCCGCTGACAGC
Target 3: TTAAGGGCGTGGTTGCGCGG -
Promoter
U6 -
Storage Condition
Store Lentiviral Vectors at -20°C. -
QC
Restriction Enzyme Digest and Sequencing -
Disclaimer
-
Caution
This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
Print/Download Datasheet
Search CoA here
Supporting Protocol
Publishing research using LA410036? Please let us know so that we can cite the reference in this datasheet.
LA410036 has not been cited in any literature.
Question
ABM community
Verified customer
Asked on Jan 30 2026
Answer
The lentivirus should be aliquoted into smaller working volumes and then stored at -80°C. Lentivirus is sensitive to storage temperature and to freeze/thaws. It can lose up to 5% or more activity with each freeze/thaw. When stored properly, viral stocks of an appropriate titer should be suitable for use for up to one year. After long-term storage, we recommend re-titering your viral stocks before use.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
abm lentiviral transfer vectors use the third generation lentivirus system. It is based on the inactivated HIV genome. Note that our lentivirus packaging plasmids cannot be integrated into the host and are transiently expressed.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
MOI (Multiplicity of Infection) refers to the number of viral particles per cell used in the infection, e.g. an MOI of 5 indicates that there are five infectious units (IU) or transducing units (TU) for every cell. MOI is determined by calculating the numbers of viral particles added per well then divide this number by the number of cells seeded into the well. We also recommend transducing the cells with a range of MOIs as different cell types may require different MOIs for successful transduction.
MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
The concentration must be optimized for each cell type. Typical selection amounts are around 0.1 - 0.5µg per ml.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
Optimal cell density for lentiviral transduction is generally 50-70% confluent for most cell types. Certain cell lines may require the optimal cell density to be determined experimentally.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
These are medium-high copy plasmids and should be propagated in a cloning E. coli strain such as DH5α. Typical yields from a 250ml culture is 300-500µg plasmid DNA.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
Standard delivery of abm’s vectors are in liquid format supplied in TE buffer (10mM Tris, 1mM EDTA, pH 8.0). Our vectors can also be ordered and delivered in agar stabs for an additional fee.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
Typically vectors are supplied at 100ng/µl.
ABM Scientific Support
Answered on Jan 30 2026
Question
ABM community
Verified customer
Asked on Jan 30 2026
Answer
We recommend storing abm’s vectors at -20°C and avoiding repeated freeze/thaws as this may affect plasmid integrity and cloning efficiency.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
MOI stands for multiplicity of infection. Theoretically, an MOI of 1 will provide 1 virus particle for each cell on a plate, while an MOI of 10 represents ten virus particles per cell. However, several factors can influence the optimal MOI including cell line, cell type, transduction efficiency and gene of interest. We recommend first establishing an optimal MOI for each cell line. This can be done using a range of MOIs (0, 0.5, 1, 2, 5, 10, 50) to determine the MOI required to obtain optimal gene expression
ABM Scientific Support
Answered on Jan 30 2026
Prev
Next
There are currently no reviews for LA410036.
Please use the link above to contact us or submit feedback about this product.
×
Current vector selected:
1110008P14Rik CRISPRa sgRNA lentivector (set of three targets)(Mouse)
Cat. No.
LA410036
Plasmid DNA Services
Midiprep Plasmid Amplification (3 Plasmids) (Add-on)
10-20 µg each
$225.00
Maxiprep Plasmid Amplification (3 Plasmids) (Add-on)
80-100 µg each
$450.00
3 Bacterial Agar Stabs (Add-on)
3 stabs
$120.00
Virus Packaging Services
Lentivirus packaging at 108 IU/ml Titer, set of 3 viruses (Mini) (Add-on)
3 x 250 µl per virus
$300.00
Lentivirus packaging at 109 IU/ml Titer, set of 3 viruses (Regular) (Add-on)
4 x 100 µl per virus
$900.00
Lentivirus packaging at 1010 IU/ml Titer, set of 3 viruses (Ultra-pure) (Add-on)
10 x 50 µl per virus
$2,200.00
Controls and Related Products
CRISPRa dCas9-VPR Lentiviral Vector
K097
10 µg
$212.00
CRISPRa dCas9-VPR Lentivirus
K098
3 x 250 µl
$643.00
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
2nd Generation Packaging Mix
LV003
200 µl
$293.00
3rd Generation Packaging Mix
LV053
200 µl
$355.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
Empty
×
Current vector selected:
1110008P14Rik CRISPRa sgRNA lentivector (set of three targets)(Mouse)
Cat. No.
LA410036
Controls and Related Products
CRISPRa dCas9-VPR Lentiviral Vector
K097
10 µg
$212.00
CRISPRa dCas9-VPR Lentivirus
K098
3 x 250 µl
$643.00
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
2nd Generation Packaging Mix
LV003
200 µl
$293.00
3rd Generation Packaging Mix
LV053
200 µl
$355.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
Empty
×
The vector and the related service will be deleted together.
×
Add the Blank Control Vector to cart?
×
1110008P14Rik CRISPRa sgRNA lentivector (set of three targets)(Mouse)
LA410036
Lentivirus Packaging at 107 IU/ml Titer
CLV7-LA410036
Lentivirus Packaging at 108 IU/ml Titer
CLV8-LA410036
Lentivirus Packaging at 109 IU/ml Titer
CLV9-LA410036
Lentivirus Packaging at 1010 IU/ml Titer (Ultra-pure)
CLV10-LA410036