HEY2 CRISPRa sgRNA lentivector (set of three targets)(Human)

  • Retired Cat.No.

    23228121
  • Product Name

    HEY2 CRISPRa sgRNA lentivector (set of three targets)(Human)
  • Unit

    3 x 1.0μg DNA
  • Description

    Save 30% OFF Packaging Mix or Transduction Enhancer with any lentivector or lentivirus. Click here to claim your savings!
    abm’s Activation sgRNA lentivectors/lentiviruses are ready to use in your CRISPR Activation experiment. The lentivector/lentivirus products come as a set of three sgRNA targets which are designed to be used with dCas9-VPR. When paired together, the sgRNAs guide dCas9-VPR to the 5’ UTR of the target gene resulting in transcriptional upregulation.
  • Gene Name/Gene ID

    HEY2, 23493
  • Gene Full Name

    hairy/enhancer-of-split related with YRPW motif 2
  • Alias

    bHLHb32, HERP1
  • Accession Number

  • Species

    Human
  • System

    Lentiviral Vector
  • Target Sequence

    Target 1: GCTCTGGGGTACCAGGTCCG
    Target 2: AGCCACGCCGACCAGCGAGG
    Target 3: CCAGCCGAGGCGTGGGAACG
  • Promoter

    U6
  • Storage Condition

    Store Lentiviral Vectors at -20°C.
  • QC

    Restriction Enzyme Digest and Sequencing
  • Disclaimer

  • Caution

    This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
    Publishing research using LA123228? Please let us know so that we can cite the reference in this datasheet.
    LA123228 has not been cited in any literature.
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    The lentivirus should be aliquoted into smaller working volumes and then stored at -80°C. Lentivirus is sensitive to storage temperature and to freeze/thaws. It can lose up to 5% or more activity with each freeze/thaw. When stored properly, viral stocks of an appropriate titer should be suitable for use for up to one year. After long-term storage, we recommend re-titering your viral stocks before use.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    abm lentiviral transfer vectors use the third generation lentivirus system. It is based on the inactivated HIV genome. Note that our lentivirus packaging plasmids cannot be integrated into the host and are transiently expressed.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    MOI (Multiplicity of Infection) refers to the number of viral particles per cell used in the infection, e.g. an MOI of 5 indicates that there are five infectious units (IU) or transducing units (TU) for every cell. MOI is determined by calculating the numbers of viral particles added per well then divide this number by the number of cells seeded into the well. We also recommend transducing the cells with a range of MOIs as different cell types may require different MOIs for successful transduction.

    MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    The concentration must be optimized for each cell type.  Typical selection amounts are around 0.1 - 0.5µg per ml.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    Optimal cell density for lentiviral transduction is generally 50-70% confluent for most cell types. Certain cell lines may require the optimal cell density to be determined experimentally.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    These are medium-high copy plasmids and should be propagated in a cloning E. coli strain such as DH5α. Typical yields from a 250ml culture is 300-500µg plasmid DNA.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    Standard delivery of abm’s vectors are in liquid format supplied in TE buffer (10mM Tris, 1mM EDTA, pH 8.0). Our vectors can also be ordered and delivered in agar stabs for an additional fee.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    Typically vectors are supplied at 100ng/µl.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    We recommend storing abm’s vectors at -20°C and avoiding repeated freeze/thaws as this may affect plasmid integrity and cloning efficiency.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    MOI stands for multiplicity of infection. Theoretically, an MOI of 1 will provide 1 virus particle for each cell on a plate, while an MOI of 10 represents ten virus particles per cell. However, several factors can influence the optimal MOI including cell line, cell type, transduction efficiency and gene of interest. We recommend first establishing an optimal MOI for each cell line. This can be done using a range of MOIs (0, 0.5, 1, 2, 5, 10, 50) to determine the MOI required to obtain optimal gene expression
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    10^7 IU/ml = DMEM
    10^8, 10^9, 10^10 IU/ml = 1X PBS (pH 7.4) with 2% PEG6000
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    A general Plasmid Amplification Protocol can be found here.

    We recommend transforming abm’s plasmids into our ProClone™ Competent Cells (Cat. No. E003). The ProClone™ Competent Cells are high-efficiency chemically competent DH5α (E. coli) cells ideal for routine plasmid amplification due to its high yield, rapid growth, and high transformation efficiency, with recA⁻ and endA⁻ mutations that ensure plasmid stability and high DNA quality. Other common compatible cloning strains include TOP10 (DH10B derivatives).
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    1. Use a sterile loop or pipette tip to scrape a small amount of cells from the agar stab. Only a tiny amount is needed as it contains live E. coli.
    2. Gently streak the cells onto an agar plate containing the correct antibiotic selection in order to achieve single isolated colonies.
    3. Place the plate “agar side up” and incubate at 37°C overnight.
    4. Select a single colony from the plate for downstream applications, such as an overnight broth culture and grow E. coli to late exponential-early stationary phase. 4a. The broth culture can be subjected to miniprep plasmid extraction. We recommend using abm’s Column-Pure Plasmid Miniprep Kit (Cat. No. G4003). 4b. The broth culture can be used to prepare a glycerol stock for long-term storage. Mix culture with sterile glycerol to a final concentration of 15% and store at -80°C.
    ABM Scientific Support
    Answered on Jan 30 2026
    Answer
    We recommend first checking the following parameters:
    1. Cell density. If density is too low, this can also result in cell death.
    We recommend the following experiments:
    Initial Experiment
    •Transduce lentivirus into the 293T cell line - one of the easiest cell lines to transduce. If the transduced cells survive selection, then troubleshooting should focus on post-virus production steps. If the transduced cells didn't survive selection, the troubleshooting should focus on virus packaging steps.
    Virus Packaging Troubleshooting
    •Attempt lentivirus packaging using a GFP expressing control vector. If packaging is successful with the control, then repeat packing of the lentivirus in question with a GFP batch control to ensure no errors with the first production. If no GFP signal is observed after transfection or ~72h after a test transduction of a GFP control lentivirus on 293T cells, then the packaging process needs to be assessed.  Packaging process assessment includes reagent quality, cell health, and packaging protocol details.
    Post-Virus Production Troubleshooting
    •Assess if the correct antibiotic concentration is used. This can be done by performing a drug-killing curve. To set up a drug-killing curve, we recommend using the same culture size and seeding density for your actual selection, and adding a different puromycin concentration to each sample, with the range between 0-1 ug/ml. If the cells are not killed at the 1ug/ml, you may try increasing the range higher concentrations. It is important to identify the concentration that results in >95% cell death in 1-4 days to establish the minimal concentration to use for the selection process.
    •Assess if the correct MOI is used to transduce the target cells. This can be done by using a GFP control lentivirus to transduce the target cells at a range around literature-recommended MOIs to determine the optimal MOI for transduction.
    •Assess if a transduction enhancer such as the ViralEntry Transduction Enhancer (Cat.No. G515) is necessary. Some cell lines are more difficult to transduce than others and by using a transduction enhancer can lead to increased target cell permeability.
    ABM Scientific Support
    Answered on Jan 30 2026
    Answer
    1. This often happens to primary cells which are very sensitive to culture medium conditions. Try to use a higher titer virus in order to limit the volume of exogenous media added to your cells.
    2. Virus preparation might be contaminated with bacteria. Use a 0.25µm syringe filter to clear the virus preparation and repeat transduction following strict sterile technique.
    3. Cell line might be contaminated with mycoplasm. This type of contamination is often not immediately obvious. The contamination effect is amplified after virus transduction. Repeat transduction with fresh cells.
    4. The virus preparation may contain some cell debris which could be mistaken as a change in cell morphology. Normally this issue will disappear 3-5 days after virus transduction.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    A complete list of controls can be found on abm’s Control Vectors and Viruses page.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 29 2026
    Answer
    • Verify plasmid quality: Confirm the plasmid is intact, at sufficient concentration, and free of contaminants (e.g., salts, ethanol, nucleases).

    • Check the host strain: Use a suitable cloning strain (e.g., recA⁻/endA⁻ such as DH5α) and confirm cells are competent and not expired.

    • Confirm selection conditions: Make sure the correct antibiotic is used at the proper concentration and that plates/media are fresh.

    • Review transformation conditions: Ensure the transformation method (chemical or electrocompetent) and recovery time are appropriate.

    • Assess plasmid compatibility: Large, low-copy, toxic, or unstable plasmids may require specialized strains or growth conditions.

    • Inspect growth conditions: Verify incubation temperature, shaking speed, and culture time.

    • Check plasmid sequence/features: Look for toxic genes, strong promoters, or repeats that may reduce stability.

    ABM Scientific Support
    Answered on Jan 29 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    These constructs are a collection of lentiviral vectors that express sgRNAs targeting the upstream 5′ UTR of a specific gene. When combined with dCas9-VPR, they mediate targeted gene activation by recruiting transcriptional activators. In contrast, pairing the sgRNAs with dCas9-KRAB results in targeted gene repression through KRAB-mediated transcriptional silencing.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    We recommend using dCas9-VPR for gene activation experiments and dCas9-KRAB for gene repression experiments. 
    ABM Scientific Support
    Answered on Jan 30 2026
    Prev
    Next
    There are currently no reviews for LA123228.
    Please use the link above to contact us or submit feedback about this product.
×
Current vector selected:
HEY2 CRISPRa sgRNA lentivector (set of three targets)(Human)
Cat. No.
LA123228
Plasmid DNA Services
Midiprep Plasmid Amplification (3 Plasmids) (Add-on)
10-20 µg each
$225.00
Maxiprep Plasmid Amplification (3 Plasmids) (Add-on)
80-100 µg each
$450.00
3 Bacterial Agar Stabs (Add-on)
3 stabs
$120.00
Virus Packaging Services
Lentivirus packaging at 108 IU/ml Titer, set of 3 viruses (Mini) (Add-on)
3 x 250 µl per virus
$300.00
Lentivirus packaging at 109 IU/ml Titer, set of 3 viruses (Regular) (Add-on)
4 x 100 µl per virus
$900.00
Lentivirus packaging at 1010 IU/ml Titer, set of 3 viruses (Ultra-pure) (Add-on)
10 x 50 µl per virus
$2,200.00
Controls and Related Products
CRISPRa dCas9-VPR Lentiviral Vector
K097
10 µg
$212.00
CRISPRa dCas9-VPR Lentivirus
K098
3 x 250 µl
$643.00
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
2nd Generation Packaging Mix
LV003
200 µl
$293.00
3rd Generation Packaging Mix
LV053
200 µl
$355.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
Empty
×
Current vector selected:
Cat. No.
Controls and Related Products
CRISPRa dCas9-VPR Lentiviral Vector
K097
10 µg
$212.00
CRISPRa dCas9-VPR Lentivirus
K098
3 x 250 µl
$643.00
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
2nd Generation Packaging Mix
LV003
200 µl
$293.00
3rd Generation Packaging Mix
LV053
200 µl
$355.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
Empty
×
The vector and the related service will be deleted together.
×
Add the Blank Control Vector to cart?
×
HEY2 CRISPRa sgRNA lentivector (set of three targets)(Human)
LA123228
Lentivirus Packaging at 107 IU/ml Titer
CLV7-LA123228
Lentivirus Packaging at 108 IU/ml Titer
CLV8-LA123228
Lentivirus Packaging at 109 IU/ml Titer
CLV9-LA123228
Lentivirus Packaging at 1010 IU/ml Titer (Ultra-pure)
CLV10-LA123228
;